| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.008189 |
| Chromosome: | chromosome 12 |
| Location: | 3812897 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g514750 | CIS1 | Citrate synthase, mitochondrial; (1 of 1) 2.3.3.1//2.3.3.16 - Citrate (Si)-synthase / Citrate oxaloacetate-lyase ((pro-3S)-CH(2)COO->acetyl-CoA) // Citrate synthase (unknown stereospecificity) / Oxaloacetate transacetase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCCGGTGAGTAACACCCGGGCGGCAGCCCGCCTTAGGCTGCATACCAAC |
| Internal bar code: | ATAGAGCTACCAGACAGATGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 321 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGACAAGTAGCACCGGTGG |
| Suggested primer 2: | GAACTGCATGAGAACCCGGA |