Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.008212 |
Chromosome: | chromosome 4 |
Location: | 2861373 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g224350 | MOT55 | Predicted protein; (1 of 22) PTHR10994 - RETICULON | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGAACCAGGGCCGAACCCAAGGCCCCCTTCCAGGGCGGGTCGCTGCTAA |
Internal bar code: | TCTTGTTTATCTCACTCTGACT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4035 |
LEAP-Seq percent confirming: | 99.2424 |
LEAP-Seq n confirming: | 131 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 132 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACACGCATCGCATACACTG |
Suggested primer 2: | GCATGTACATGACCGCGTTC |