| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.008246 |
| Chromosome: | chromosome 7 |
| Location: | 3939730 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g339554 | (1 of 1) K03372 - MFS transporter, PAT family, solute carrier family 33 (acetyl-CoA transportor), member 1 (ACATN, SLC33A1) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCATGGGCCGCCGCAAGTCCTGGATCGTGCCGATCCAGCTCCTGACAGCT |
| Internal bar code: | GATTCTAGGAAACGTTTATCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1760 |
| LEAP-Seq percent confirming: | 95.8333 |
| LEAP-Seq n confirming: | 23 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGACCCTCACCCCCATCTA |
| Suggested primer 2: | GATCCCTGGATGACCTGTGC |