| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.008373 |
| Chromosome: | chromosome 3 |
| Location: | 7932036 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g202300 | (1 of 3) IPR000104//IPR001859 - Antifreeze protein, type I // Trypanosoma cruzi ribosomal protein P2-like | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAAACAAGCGAGGCTGACACTGCCAGTTCCGTCCCTGCTATCACATGCG |
| Internal bar code: | GATCTACTATTTCACGCGTATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2041 |
| LEAP-Seq percent confirming: | 95.7447 |
| LEAP-Seq n confirming: | 45 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 47 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGGCGCTTCGAAACTTGTA |
| Suggested primer 2: | CAGCGGCATTCATTGATGGG |