| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.008390 |
| Chromosome: | chromosome 13 |
| Location: | 4047615 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g590700 | (1 of 4) PTHR16255//PTHR16255:SF4 - UNCHARACTERIZED // SPORULATION PROTEIN RMD8 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAAACACACACACATACACGCACGCATCCACGGACATGCACAACGCGCC |
| Internal bar code: | TATTATCCACGGTTCGCCTGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 616 |
| LEAP-Seq percent confirming: | 10.7692 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 58 |
| LEAP-Seq n unique pos: | 65 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCCTTACTTTATCGGGCCC |
| Suggested primer 2: | TGCAAAAGAGCGAGGAGGAG |