| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.008551 |
| Chromosome: | chromosome 5 |
| Location: | 918009 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g246550 | LAO3 | (1 of 3) PTHR10742//PTHR10742:SF288 - AMINE OXIDASE // SUBFAMILY NOT NAMED; L-amino-acid oxidase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTAATCCCAAGCACAAACCCTCAACCCCCAAACCCCAAATCCCAACCC |
| Internal bar code: | TACTGTAGGCGATGATGTGGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2484 |
| LEAP-Seq percent confirming: | 54.5455 |
| LEAP-Seq n confirming: | 36 |
| LEAP-Seq n nonconfirming: | 30 |
| LEAP-Seq n unique pos: | 66 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCACACACACGGACACACA |
| Suggested primer 2: | GGAACATAGCCGTGAACCCA |