Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.008558 |
Chromosome: | chromosome 2 |
Location: | 4801264 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g109000 | (1 of 2) PF03254 - Xyloglucan fucosyltransferase (XG_FTase) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCTGCGCAGCCTCCTCCTCCTCGTCCTCCGAGACTGCCTGCCCCTGGC |
Internal bar code: | TTGGGAAGTTAGCGATATGATG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1186 |
LEAP-Seq percent confirming: | 75.0 |
LEAP-Seq n confirming: | 21 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCGTCGTCATCATCGTCGTC |
Suggested primer 2: | ACTTAGCCATGCCAGACCAC |