Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.008601 |
Chromosome: | chromosome 2 |
Location: | 7196211 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g390763 | RAB2,FAP354 | Rab-like GTP-Binding Flagellar Associated Protein 354; (1 of 1) K07877 - Ras-related protein Rab-2A (RAB2A) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACGTGGTGCGCTGCCTTGCCACCAACAGGCGTTCATCAACACCGCGAAG |
Internal bar code: | CGAGGTCTACTAGCGAGACTTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4662 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 11 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACACGTCACGCCAATACAGT |
Suggested primer 2: | ACTCAGCATGCATGAGGCTT |