| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.008685 |
| Chromosome: | chromosome 13 |
| Location: | 1013341 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g568450 | KIN7C,KIN7-3 | Kinesin motor protein; (1 of 1) PTHR24115//PTHR24115:SF535 - FAMILY NOT NAMED // KINESIN-RELATED PROTEIN 4 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATCTGCACACGAGTGCGGCTTCGGGTGTGAGCCCACCTCTCCTCCTTGA |
| Internal bar code: | TCCGTTAAGGACGTAGGTCTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1550 |
| LEAP-Seq percent confirming: | 83.3333 |
| LEAP-Seq n confirming: | 15 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGTGTTACGTCCCGCAGTT |
| Suggested primer 2: | TCACTCTGCTTGGCCATGAG |