Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.008701 |
Chromosome: | chromosome 16 |
Location: | 82376 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g695700 | (1 of 12) PF04749 - PLAC8 family (PLAC8) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCAAGGATGCTTACCAATTCGCCATCACATTGCAGTGCATCAACGCCGC |
Internal bar code: | CAGTATAAGATGGCTCAGTGAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2652 |
LEAP-Seq percent confirming: | 97.6744 |
LEAP-Seq n confirming: | 84 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 86 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACCTTAAGATGCACCCCTGC |
Suggested primer 2: | GGCCCCATGTATGACCCAAA |