Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.008764 |
Chromosome: | chromosome 13 |
Location: | 1229435 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g570300 | UBC24 | (1 of 1) K13960 - ubiquitin-conjugating enzyme E2 T (UBE2T, HSPC150); E2 Ubiquitin conjugating enzyme | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGCCGTTGACGCGGGTGGGTTGCAGTGTGCGACATCTCTTTTAAGACC |
Internal bar code: | CGAGGTACCACTTGGTTCGATC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 659 |
LEAP-Seq percent confirming: | 81.25 |
LEAP-Seq n confirming: | 26 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTGAGCTATGCTTCGGGTGG |
Suggested primer 2: | GAAAGCAGTTCAGCAGGTGC |