| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.008766 |
| Chromosome: | chromosome 10 |
| Location: | 2103594 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g433050 | ARCS,DRP5B,ARC5,DRP8 | Putative dynamin GTPase involved in plastid division; (1 of 1) PTHR11566:SF78 - DYNAMIN-LIKE PROTEIN ARC5 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACAGGTTGTGGCTCTGCCGTGTGTTTCGATGGCAACTGCGAAGCTTGCA |
| Internal bar code: | GTTGAGACCGGTCCTGCTGCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1586 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 27 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGGGGGAGGTGTATAGGGT |
| Suggested primer 2: | ACACTGAGGCTTGACGAGTG |