| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.008782 |
| Chromosome: | chromosome 7 |
| Location: | 2632162 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g330400 | KCN1 | (1 of 1) K04886 - potassium voltage-gated channel Shab-related subfamily B member 2 (KCNB2); Six-transmembrane domain potassium channel alpha subunit | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTCATGGGGCAGTGAAATATGACTGGGGTCGAACCGCGGCCTGCGTGCA |
| Internal bar code: | GGGCTTGTATTGCGGGGACGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1923 |
| LEAP-Seq percent confirming: | 92.3077 |
| LEAP-Seq n confirming: | 36 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCGCGTCCTTATCTAGTGC |
| Suggested primer 2: | GTGGCTGCTGATGACTGAGT |