Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.008944 |
Chromosome: | chromosome 11 |
Location: | 3357695 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g476850 | PF2,DRC4,GAS8 | (1 of 1) PTHR31543//PTHR31543:SF0 - FAMILY NOT NAMED // GROWTH ARREST-SPECIFIC PROTEIN 8; Nexin-dynein regulatory complex 4 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCGTGTCGCTGCAGCACCGCGCCCAGACGCCCACCTGCCGCGTCTGCA |
Internal bar code: | TCGCGGGTTTCTGCCAAGTTCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 777 |
LEAP-Seq percent confirming: | 85.7143 |
LEAP-Seq n confirming: | 6 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AACGCTGAAGTCTCACCTGG |
Suggested primer 2: | CACGCATATCAAACCGCTGG |