Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.008968 |
Chromosome: | chromosome 12 |
Location: | 3607468 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g801394 | (1 of 8) IPR001163//IPR010920 - LSM domain, eukaryotic/archaea-type // LSM domain | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGATAATCACACACGCGTGTGTCCGTGCCGCGCCCTGCCCACACTCGGCG |
Internal bar code: | CGGGCCCCCTCCGGGCCTCTAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1235 |
LEAP-Seq percent confirming: | 56.25 |
LEAP-Seq n confirming: | 27 |
LEAP-Seq n nonconfirming: | 21 |
LEAP-Seq n unique pos: | 48 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGTCCACAGACATGGCCATG |
Suggested primer 2: | CATCCCTCCCACACACTTCC |