| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.008988 |
| Chromosome: | chromosome 17 |
| Location: | 389246 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g698600 | LIPG3,LIP3 | (1 of 2) IPR006693//IPR029058 - Partial AB-hydrolase lipase domain // Alpha/Beta hydrolase fold; Putative triacylglycerol lipase | CDS |
| Cre17.g698650 | GGT1,GTP1 | Gamma-glutamyl transpeptidase; (1 of 1) 2.3.2.2//3.4.19.13 - Gamma-glutamyltransferase / Glutamyl transpeptidase // Glutathione hydrolase / Glutathionase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCTCGAAAAGCGATTTCGGTTCGCCGCTCGCTTGCATGGCGCCACCTCC |
| Internal bar code: | GGTAAATGTTGGTCCTCCATTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1501 |
| LEAP-Seq percent confirming: | 66.6667 |
| LEAP-Seq n confirming: | 16 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTGCGGCGGTAGCTATAGG |
| Suggested primer 2: | GCTCAGTTACAGCCACCCAT |