| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.009006 |
| Chromosome: | chromosome 4 |
| Location: | 3811857 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g229700 | UGP1,UGP | (1 of 1) K00963 - UTP--glucose-1-phosphate uridylyltransferase (UGP2, galU, galF); UDP-glucose pyrophosphorylase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGGGTTGTAAATACCAGCCCGAACTAAACCAAAACCAACGAAGACGAG |
| Internal bar code: | AGGCGGTCTACGTGGCCGCAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1006 |
| LEAP-Seq percent confirming: | 14.6341 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 35 |
| LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCATACCTCTCCCTCCCCAA |
| Suggested primer 2: | CACCCATAAACCCCCTCACC |