| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.009146 |
| Chromosome: | chromosome 2 |
| Location: | 2721726 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g093600 | TEH3 | (1 of 6) PF03061 - Thioesterase superfamily (4HBT); Thioesterase-like protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACGTCTGGAGACGACCCCAGAAGTCAGCTACGACGGCAAGTCCAATGCT |
| Internal bar code: | TTGAAGGCTGGTTAGAACTAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3658 |
| LEAP-Seq percent confirming: | 96.8553 |
| LEAP-Seq n confirming: | 154 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 159 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGGCTTGCAAGGGTTACTA |
| Suggested primer 2: | TAAGCGGGGTATCTGGGTCA |