| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.009183 |
| Chromosome: | chromosome 3 |
| Location: | 1422821 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g150900 | (1 of 1) IPR011146//IPR016030//IPR027417 - HIT-like domain // Adenosylcobalamin biosynthesis, ATP:cob(I)alamin adenosyltransferase-like // P-loop containing nucleoside triphosphate hydrolase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGGATCCTATACTACCTTCGTAGTGGATTTGTTCGGCGAGGTGATAAGG |
| Internal bar code: | TATTTCGTTAATTGTGTGTATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 979 |
| LEAP-Seq percent confirming: | 14.2857 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 48 |
| LEAP-Seq n unique pos: | 56 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTCTCGCATGCATGGGATA |
| Suggested primer 2: | GTCGTTGCTGTAGGTGGTGA |