| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.009191 |
| Chromosome: | chromosome 2 |
| Location: | 8145062 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g144002 | PUS20 | (1 of 2) 5.4.99.24 - 23S rRNA pseudouridine(955/2504/2580) synthase; RNA pseudouridine synthase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGTTGTTGGTGTGAAGGTGGTGGGAGATGGTGGGAGGTGGGGGCGGGGG |
| Internal bar code: | CTTAGTACCTCTGCCACAGATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 195 |
| LEAP-Seq percent confirming: | 76.9231 |
| LEAP-Seq n confirming: | 10 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTACACAGGCAGTTCAGGT |
| Suggested primer 2: | GAAGGTCCTGTGCGTGTGTA |