| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.009270 |
| Chromosome: | chromosome 16 |
| Location: | 7185383 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g676757 | PTB8 | (1 of 9) K14640 - solute carrier family 20 (sodium-dependent phosphate transporter) (SLC20A, PIT); Sodium/phosphate symporter | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTTTGACCCGGACACGGAGTACGCCTTCCGCTACCTGCAGGTGGGTGC |
| Internal bar code: | TGGAGATTGCGTTAGGCTATGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 174 |
| LEAP-Seq percent confirming: | 50.0 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTCAACACCTCTCCCCCAC |
| Suggested primer 2: | ATGGACTGGACTCGCAAGTG |