| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.009322 |
| Chromosome: | chromosome 2 |
| Location: | 6506966 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g388850 | FAP329,ACA1 | Flagellar Asociated Protein 329; (1 of 1) PF00122//PF00689//PF00690//PF12710 - E1-E2 ATPase (E1-E2_ATPase) // Cation transporting ATPase, C-terminus (Cation_ATPase_C) // Cation transporter/ATPase, N-terminus (Cation_ATPase_N) // haloacid dehalogenase-like hydrolase (HAD) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAAGAAGATGATGGCAGGTGCGAAAGCCGGGTAGCAGCGGGGGCGGCTG |
| Internal bar code: | AATGTGTCCGTGATCAAACACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2384 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCCTGTCTCCCACTCTCTA |
| Suggested primer 2: | CATCTGCTGCTTCATCGCAC |