| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.009343 |
| Chromosome: | chromosome 17 |
| Location: | 6648942 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g745797 | (1 of 40) IPR000182//IPR016181 - GNAT domain // Acyl-CoA N-acyltransferase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTATCAGTAGCAGCCGCATCTGCTCCCGCGCGCGCCTGGCTGTGGCGCT |
| Internal bar code: | AATTTGGCTGGAAAAATGTCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2807 |
| LEAP-Seq percent confirming: | 8.33333 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGAAGAGGGAGGAAGCAAC |
| Suggested primer 2: | CGACCTCCATCCAGATCACG |