| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.009354 |
| Chromosome: | chromosome 16 |
| Location: | 617996 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g692050 | SYP3 | (1 of 1) K08490 - syntaxin 5 (STX5); ER-Golgi Qa-SNARE protein, Syntaxin5/Syx5/Sed5/Syp3-family (Qa.II) | CDS |
| lncRNA_TCONS_00196237 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCCCTCCGACGTAAACGGCTCAGCGGCCACGTCCAGCCCGCACCACCTC |
| Internal bar code: | CACGGTACCAAAAAGGATCGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 364 |
| LEAP-Seq percent confirming: | 89.4737 |
| LEAP-Seq n confirming: | 17 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTCGGGCATTGAAGACTGG |
| Suggested primer 2: | GCCAAGACGCTGGAACTAGT |