Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.009371 |
Chromosome: | chromosome 16 |
Location: | 5830563 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g679900 | XRN3 | 5' to 3' exoribonuclease; (1 of 1) K12619 - 5'-3' exoribonuclease 2 (XRN2, RAT1) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTCAATTCTTGCAAGTGCGCACGCTCCTCCCACCTCCTTTTCCCTACGG |
Internal bar code: | GAGTTGATATTGCCCCGCTCTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 517 |
LEAP-Seq percent confirming: | 81.8182 |
LEAP-Seq n confirming: | 9 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATCCCCGCGAAGAAGTTACC |
Suggested primer 2: | GCCTTGCCCTAACCAGTGAT |