| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.009375 |
| Chromosome: | plastome |
| Location: | 128335 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802317 | atpH,ChreCp053,2717044 | ATPase III subunit; (1 of 1) K02110 - F-type H+-transporting ATPase subunit c (ATPF0C, atpE) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTCGCTTTCATGGAATCTTTAACAATTTACGGTCTAGTTGTTGCTTTAG |
| Internal bar code: | GTGAAAACATCGTAGAATGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1054 |
| LEAP-Seq percent confirming: | 63.6364 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGGAAGCACCAAAGGCAGT |
| Suggested primer 2: | CCTTCCGCAGAGGGTGAAAT |