| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.009421 |
| Chromosome: | plastome |
| Location: | 181475 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802330 | orf2971,ftsH,ChreCp065,2716962 | ATP-dependent zinc metalloprotease; (1 of 752) IPR027417 - P-loop containing nucleoside triphosphate hydrolase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATTTTAGTCTTACATTATTAAAAAAACAGTTTGTAACAGTAAAACCATT |
| Internal bar code: | TATTTGCTACACGGAATTCTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 141 |
| LEAP-Seq percent confirming: | 17.2414 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGTGCTAGCTGGTCCTAGTG |
| Suggested primer 2: | GCAAAGGAAACTCAGAGAGCC |