| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.009451 |
| Chromosome: | chromosome 14 |
| Location: | 835199 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g612950 | CYG17 | (1 of 70) 4.6.1.2 - Guanylate cyclase / Guanylyl cyclase; Adenylate/guanylate cyclase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGACCTGTTCGTGGTCGGTGGCGGTGGCGGTGGGGTCCGGCATCGCAC |
| Internal bar code: | ATGAAGCAAGACCCCTATATCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1677 |
| LEAP-Seq percent confirming: | 96.4286 |
| LEAP-Seq n confirming: | 54 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 56 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGCAGGCAGAGGTGTTAGT |
| Suggested primer 2: | CCCCCGGACATATCCACATG |