Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.009539 |
Chromosome: | chromosome 8 |
Location: | 1501883 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g364850 | AC115 | putative ADP-ribosylglycosylhydrolase; (1 of 4) PTHR16222//PTHR16222:SF17 - ADP-RIBOSYLGLYCOHYDROLASE // SUBFAMILY NOT NAMED | 3'UTR |
Cre08.g364862 | (1 of 1) PF07714//PF13185 - Protein tyrosine kinase (Pkinase_Tyr) // GAF domain (GAF_2) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTAAACTGCAAGGCTCACTCTTTGCTCGCCTCCAATAATTCTGCCATTGT |
Internal bar code: | CTTGGGGTAGAGACGCTATTTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2474 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 34 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GACACGCTGCTGCTTTGAAA |
Suggested primer 2: | CAGTGGGCGTTGGTTGAAAG |