Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.009637 |
Chromosome: | chromosome 3 |
Location: | 5118963 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g180650 | DEG7 | (1 of 2) PTHR22939//PTHR22939:SF66 - SERINE PROTEASE FAMILY S1C HTRA-RELATED // PRO-APOPTOTIC SERINE PROTEASE NMA111; Deg protease | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCACCGCGCCGCGCAGGGCCGCGCCAACGTGCCCAAATGCGCCATTAT |
Internal bar code: | CTACTGAATTTGTGAATATTCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2362 |
LEAP-Seq percent confirming: | 67.6056 |
LEAP-Seq n confirming: | 48 |
LEAP-Seq n nonconfirming: | 23 |
LEAP-Seq n unique pos: | 71 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATAGTCCCGCGTCCAGTAC |
Suggested primer 2: | TGTGGGAAATCGGGAAGTGG |