| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.009698 |
| Chromosome: | chromosome 1 |
| Location: | 6151249 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g043750 | BBS7 | (1 of 1) K16749 - Bardet-Biedl syndrome 7 protein (BBS7); Bardet-Biedl syndrome-7 associated protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCCATACTAAACCAAACCCAATGCAATAGAGCGAGGAGGAGAGCGTGGT |
| Internal bar code: | GGGTCTCGGGATAATACGGTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 298 |
| LEAP-Seq percent confirming: | 33.3333 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAAATCGCGATACCTCCCG |
| Suggested primer 2: | ACCGTACAGCCCTATCCTGT |