| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.009706 |
| Chromosome: | chromosome 17 |
| Location: | 2136528 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g711950 | PFP1 | Prefoldin-family protein; (1 of 1) PTHR13345//PTHR13345:SF4 - NUT2 AND UXT // PROTEIN UXT | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTGGGGCGGGCGTGTCCAGTTACACTGGGAGGGCCAAACTGTGTCAAG |
| Internal bar code: | TCCATCCGTCTATGATACGTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2208 |
| LEAP-Seq percent confirming: | 96.5517 |
| LEAP-Seq n confirming: | 28 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATGCGGTTAGGAGGGGTTG |
| Suggested primer 2: | TGTTCCTTAGCCTGCCGAAG |