Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.009746 |
Chromosome: | chromosome 4 |
Location: | 3916517 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g230830 | (1 of 1) IPR000104//IPR001012//IPR029071 - Antifreeze protein, type I // UBX domain // Ubiquitin-related domain | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAATTTCATCCGGGCGGCTACGCGCGGTGGCCGCCTGCCTGTGTCACGTT |
Internal bar code: | GCGACGTTTTTAGAGGAGTATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1777 |
LEAP-Seq percent confirming: | 94.4444 |
LEAP-Seq n confirming: | 34 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCACACTGTACACGACTGGA |
Suggested primer 2: | CAAGCGGATCGTGTTGTGTG |