| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.009750 |
| Chromosome: | chromosome 17 |
| Location: | 1786082 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g708950 | (1 of 2) 3.2.1.58 - Glucan 1,3-beta-glucosidase / Exo-1,3-beta-glucosidase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCAGCTGCGCTGCAGCCGAGCAGTTTCGCGCAAACTGGCACAAGATTGA |
| Internal bar code: | AATTTACTGCGAAACGCAGATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3299 |
| LEAP-Seq percent confirming: | 96.5517 |
| LEAP-Seq n confirming: | 84 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 87 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCTCGCAGAACATAGTTGC |
| Suggested primer 2: | TTGCTGTGGATACCGGCAAT |