Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.009807 |
Chromosome: | chromosome 7 |
Location: | 1819021 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g325731 | (1 of 6) PF01925 - Sulfite exporter TauE/SafE (TauE) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAGTGGGATTCCCGCGACCATGCACCCCACCGTGTCGGCCAGAACCGCC |
Internal bar code: | GAGTTCTATGTTAACTGCCCGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 980 |
LEAP-Seq percent confirming: | 31.25 |
LEAP-Seq n confirming: | 5 |
LEAP-Seq n nonconfirming: | 11 |
LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATCTGGGCACAGGAAAGCTC |
Suggested primer 2: | TGTGCGAGGTCTGAATGCTT |