| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.009858 |
| Chromosome: | chromosome 13 |
| Location: | 1074606 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g568800 | NUOB13 | NADH:ubiquinone oxidoreductase 18 kDa subunit; (1 of 1) K03949 - NADH dehydrogenase (ubiquinone) 1 alpha subcomplex subunit 5 (NDUFA5) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTCCCACCTCGCTCCGTCTACTCATAGGTGCCTGTGGTGGACTACACGG |
| Internal bar code: | ATTCCACCTAGTCTTGTTTGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2663 |
| LEAP-Seq percent confirming: | 88.5714 |
| LEAP-Seq n confirming: | 31 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGAAATCCACGACTGGCAG |
| Suggested primer 2: | GCCATGATACGCACTGCTTG |