| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.009872 |
| Chromosome: | chromosome 2 |
| Location: | 5507074 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g114575 | (1 of 20) IPR010095//IPR013083 - Transposase IS605, OrfB, C-terminal // Zinc finger, RING/FYVE/PHD-type | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACACCAGCCAGGTACGCTGTGATCTTCACAAAGCAATGCGCACAACGCT |
| Internal bar code: | AACGGAAATACAATGCCCGAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 222 |
| LEAP-Seq percent confirming: | 12.5 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCAACATGCAAACAGGGCG |
| Suggested primer 2: | CGTGCTTGAAGAACGCAACA |