| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.009912 |
| Chromosome: | chromosome 12 |
| Location: | 7237038 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g558950 | (1 of 1) IPR000104//IPR009071 - Antifreeze protein, type I // High mobility group box domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAACGGTGGGTGTCGTCCTGCAGGCGGGCCGGGCCCATAGCAAGGCGCAA |
| Internal bar code: | TTATTCGATATGTCTTGTGTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2345 |
| LEAP-Seq percent confirming: | 96.5517 |
| LEAP-Seq n confirming: | 28 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGATGCGAGCCTGAATGG |
| Suggested primer 2: | GATTGCCATGGATGACGTGC |