| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.009916 |
| Chromosome: | chromosome 5 |
| Location: | 2638401 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g240050 | (1 of 1) PF13813 - Membrane bound O-acyl transferase family (MBOAT_2) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACCGCCACCGTGGGCACCGACACCTGCAGGCCCCGCCGCCGCGCCAGAA |
| Internal bar code: | TATTGTCTCTTGGGCGTCGGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 952 |
| LEAP-Seq percent confirming: | 65.2174 |
| LEAP-Seq n confirming: | 15 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTGATGGGGGTGGTTGTAG |
| Suggested primer 2: | GAAGTGCAGCTGCTGAAACC |