| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.009926 |
| Chromosome: | chromosome 17 |
| Location: | 2754666 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g717850 | PHC8 | (1 of 1) IPR003882//IPR024616//IPR027417 - Pistil-specific extensin-like protein // Pherophorin // P-loop containing nucleoside triphosphate hydrolase; Pherophorin-chlamydomonas homolog 8 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCTAGGTAGCGCGCTTGCGTCGTTAGCGGGCCGACTGGTGCGTTGGTTG |
| Internal bar code: | ATTTAGCTAGTTCCGTGAGCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2328 |
| LEAP-Seq percent confirming: | 91.7808 |
| LEAP-Seq n confirming: | 67 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 73 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGAGTCTTCTGGGTGACAA |
| Suggested primer 2: | GTGATGCAAATCTCCGCACC |