| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.009934 |
| Chromosome: | chromosome 14 |
| Location: | 3663635 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g631150 | CEP14 | (1 of 1) 2.4.2.26//2.7.11.1 - Protein xylosyltransferase / Uridine diphosphoxylose-protein xylosyltransferase // Non-specific serine/threonine protein kinase / Threonine-specific protein kinase; Cysteine endopeptidase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCTGCGCTGAGGCAGGCGTCACCGACGCCACCTGCACAGCCGTGTCGG |
| Internal bar code: | TATGGGGACATATGATAATCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1388 |
| LEAP-Seq percent confirming: | 75.9259 |
| LEAP-Seq n confirming: | 41 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 54 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGCAAAACTTCGTGGGACC |
| Suggested primer 2: | GATGTCGTCTGCGCCAAATC |