Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.010051 |
Chromosome: | chromosome 15 |
Location: | 849667 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre15.g640600 | (1 of 1) PF00775 - Dioxygenase (Dioxygenase_C) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGGGTTCAGGCAGGTTGGCGAGGTCCCGTAGGGTGCAGCTGACGCCCAT |
Internal bar code: | TTTACTTTCAGGGTATTAAATG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3083 |
LEAP-Seq percent confirming: | 88.4615 |
LEAP-Seq n confirming: | 46 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 52 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCGAATACGACGACAACAGC |
Suggested primer 2: | CTAACCACCACCAACTGCCA |