Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.010135 |
Chromosome: | plastome |
Location: | 27389 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
CreCp.g802276 | ChreCp014,2717057,rpl16 | (1 of 1) PTHR12220//PTHR12220:SF14 - 50S/60S RIBOSOMAL PROTEIN L16 // SUBFAMILY NOT NAMED; 50S ribosomal protein L16 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATCTAGTTTAATTCCATTTTACTATATTTATAGGGTTGCCTGGTACAAA |
Internal bar code: | ATTACGTTGTAGAGACGAGCAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 85 |
LEAP-Seq percent confirming: | 60.0 |
LEAP-Seq n confirming: | 3 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCGGACGTCGTGTTTTAAC |
Suggested primer 2: | GAAGGGGAAGGAGGCAGTTG |