| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.010138 |
| Chromosome: | chromosome 6 |
| Location: | 3094118 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g275300 | (1 of 3) PF05670 - Domain of unknown function (DUF814) (DUF814) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCACGCCGAGGCCGCAGGAGTGCCTGAACCGATACTGGTACCCGTCGCA |
| Internal bar code: | ATCGCCTCTAGTATCATGGGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 543 |
| LEAP-Seq percent confirming: | 84.6154 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGCCTAGTCAAGCAACCCC |
| Suggested primer 2: | GATGTCATTCGTCGTGCGTG |