Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.010139 |
Chromosome: | chromosome 13 |
Location: | 4676291 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g604050 | (1 of 1) IPR002048//IPR006626//IPR011050 - EF-hand domain // Parallel beta-helix repeat // Pectin lyase fold/virulence factor | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTCGGCGGTGGGAGCGGTGGGAGCGGTACAGCGGTAAAGCGGTGGGAGC |
Internal bar code: | TTGGCCAAGATTATTCAAGTAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 990 |
LEAP-Seq percent confirming: | 78.5714 |
LEAP-Seq n confirming: | 11 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGGGAGTTGTGGTTTTGCCT |
Suggested primer 2: | CAAGGACACCAGCAAACGTG |