| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.010184 |
| Chromosome: | chromosome 1 |
| Location: | 6523080 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g046150 | ICP55,XPA1 | (1 of 2) 3.4.11.9 - Xaa-Pro aminopeptidase / X-Pro aminopeptidase; Intermediate Cleaving Peptidase 55 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGATGCAGAACGGCAGGGGCGGGTCGGCTGGTGCAGGCCGCGAGGTGT |
| Internal bar code: | TCTCAGTTAAAAAGCTGGGTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 652 |
| LEAP-Seq percent confirming: | 84.2105 |
| LEAP-Seq n confirming: | 16 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCACTCAACACTCCCCCAC |
| Suggested primer 2: | CCATGCTGGAAAACGCAACA |