| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.010299 |
| Chromosome: | chromosome 8 |
| Location: | 1892476 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g367600 | ASL1,CYSL,CYSM,OASTL1 | (1 of 3) 2.5.1.47 - Cysteine synthase / OAS sulfhydrylase; O-acetylserine (Thiol)-lyase/cysteine synthase 1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCGAGGGGAGATGACACAAGATGGGGGCATTGGGTTGTTTGAAGCGTGC |
| Internal bar code: | TTTTACATCACAAACGGCGTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3796 |
| LEAP-Seq percent confirming: | 76.0 |
| LEAP-Seq n confirming: | 38 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 50 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGCATCTACACGGCATTGC |
| Suggested primer 2: | AGACGAGTGTTTGTCCGCAT |