| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.010301 |
| Chromosome: | chromosome 7 |
| Location: | 1472173 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g323950 | PFH23,PHX23 | Putative prolyl 4-hydroxylase; (1 of 1) PTHR10869//PTHR10869:SF50 - PROLYL 4-HYDROXYLASE ALPHA SUBUNIT // SUBFAMILY NOT NAMED | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGGGGTCCACCTGCGATACAAAACAAGCATGGTTTCAGAAGTACTGGTG |
| Internal bar code: | GGAAGGGCGACATGATGCGCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2590 |
| LEAP-Seq percent confirming: | 90.2439 |
| LEAP-Seq n confirming: | 37 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCACCATGACTAATGCTGCG |
| Suggested primer 2: | CGCTACATGCTGCCAAATCC |