Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.010425 |
Chromosome: | chromosome 2 |
Location: | 7625318 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g147850 | CLPY2,HSLU2,HUV2 | (1 of 2) K03667 - ATP-dependent HslUV protease ATP-binding subunit HslU (hslU); Peptidase subunit of mitochondrial HslUV protease | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGAATGGATGTGGAGTCGTCGAGACTTAGGGGGAGTTGTGCCCGGTAAAC |
Internal bar code: | ACAGCCATAGCACACCAGATCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1667 |
LEAP-Seq percent confirming: | 73.2143 |
LEAP-Seq n confirming: | 41 |
LEAP-Seq n nonconfirming: | 15 |
LEAP-Seq n unique pos: | 56 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTGACAAGATCGTGGAGCCC |
Suggested primer 2: | TGCGCGTGTGTTTGTACAAG |