| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.010456 |
| Chromosome: | chromosome 10 |
| Location: | 6671757 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g466350 | CDPK2,SNRK2H | (1 of 1) PTHR24343:SF169 - SERINE/THREONINE-PROTEIN KINASE SRK2D-RELATED; snRK1 family in Chlamydomonas, subgroup 2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGAAGTGCTCCCCTGGTTCGGCGCGTCACGTGACGCCGTACCCACGTCA |
| Internal bar code: | CAGTATTTGCACTTGGTCGCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 445 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTAGGCGTCAGAAACACCT |
| Suggested primer 2: | ATGGACAAATTCGAGCCCGT |